View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2941_low_10 (Length: 247)
Name: NF2941_low_10
Description: NF2941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2941_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 22 - 160
Target Start/End: Complemental strand, 21815369 - 21815231
Alignment:
| Q |
22 |
acatatccgtaagggaataacaagatgtggcaagagttgttgtgaaatagtataaaaatccaaatgttttttctctatcctagctattgtcttcatttat |
121 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21815369 |
acatatccgtaagggaataactagatgtggcaagagttgttgtgaaatagtataaaaatccaaatgttttttctctatcctagctattgtcttcatttat |
21815270 |
T |
|
| Q |
122 |
tattgttatttatgtcttctctctattaacccttctatt |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21815269 |
tattgttatttatgtcttctctctattaacccttctatt |
21815231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University