View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2941_low_8 (Length: 252)
Name: NF2941_low_8
Description: NF2941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2941_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 10 - 241
Target Start/End: Original strand, 11133927 - 11134157
Alignment:
| Q |
10 |
gatattaacacatgcttaggagtttgtttagcaaaagggaaatccattgtgaaatttaacgcctctgtatgcaattagttcctggtaggatacatgtaat |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11133927 |
gatattaacacatgcttaggagtttgtttagcaaaagggaaatccattgtgaaatttaacgcctctgcatgcaattagttcctggtaggatacatgtaat |
11134026 |
T |
|
| Q |
110 |
gtggttatgaacctaatatattctagtcgtcttcattttgatttacacccaaagtcccaaacaattagcaataattttgctgtcacctgttgtggatcac |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11134027 |
gtggttatgaacctaatatattctagtcgtcttcattttgatttacacccaaagtcccaaacaattagcaataattttgctgtca-ctgttgtggatcac |
11134125 |
T |
|
| Q |
210 |
agggcaggtttcaatatacttaacgttttttc |
241 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |
|
|
| T |
11134126 |
agggcaggtttgaatatacttaacgttttttc |
11134157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University