View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2941_low_9 (Length: 251)
Name: NF2941_low_9
Description: NF2941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2941_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 5010152 - 5010267
Alignment:
| Q |
1 |
tgcacggacagacagtgcagatttcaaccatatgtttttgtcttttttaaatcaaaatccaaccttcaaatattcatcatccgatctcgattcaatgatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| ||| |
|
|
| T |
5010152 |
tgcacggacagacagtgcagatttcaaccatatgtttttgtcttttttaaatcaaaatccaaccttcaaatattcatcttccgatctcgatgcaataatt |
5010251 |
T |
 |
| Q |
101 |
gtcgttgtggtggatg |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
5010252 |
gtcgttgtggtggatg |
5010267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University