View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2942_low_7 (Length: 242)
Name: NF2942_low_7
Description: NF2942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2942_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 3 - 151
Target Start/End: Original strand, 5042706 - 5042853
Alignment:
| Q |
3 |
catagggactattttaccccaatataaaaatatcatggacaaatgtgaatattagtcttttgtcatgtaatacatacgttccaaattataggtaattttg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
5042706 |
catagggactattttaccccaatataaaaatatcatggacaaatgtgaatattagt-ttttgtcatgtaatacatacgttccaaattataggtaacttta |
5042804 |
T |
 |
| Q |
103 |
aaaaaacaattctcttaaattataaatcgttttacaaacattaatgtta |
151 |
Q |
| |
|
||||||||||||||| ||||||||| | |||||||||| |||||||||| |
|
|
| T |
5042805 |
aaaaaacaattctctcaaattataagttgttttacaaatattaatgtta |
5042853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University