View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2943_low_11 (Length: 244)
Name: NF2943_low_11
Description: NF2943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2943_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 147
Target Start/End: Original strand, 54947242 - 54947390
Alignment:
| Q |
1 |
tttttattataaaattacttcaagcttttgacggtaatttcatttaaagnnnnnnnnnnnnnnnnnnnnngtctccaaaagttgtacaaataaatagaaa |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
54947242 |
tttttattataaaattacttcaaacttttgacggtaatttcatttaaagttttttccttattattttcttgtctccaaaagttgtacaaataaatagaaa |
54947341 |
T |
|
| Q |
101 |
tctttaaatgttattattat--ttttcttctaaaaaagagtaaccatag |
147 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
54947342 |
tctttaaatgtgattattattattttcttctaaaaaagagtaaccatag |
54947390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 128 - 228
Target Start/End: Original strand, 54947463 - 54947560
Alignment:
| Q |
128 |
ctaaaaaagagtaaccatagnnnnnnngatattccaagtttcaattgtttagtccatgtctgatttgagatatactatatcccacctaatgaggaaattc |
227 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54947463 |
ctaaaaaagagtaaccatagtttttt-gatattccaagtttcaattgt--agtccatgtctgatttgagatatactatatcccacctaatgaggaaattc |
54947559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University