View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2943_low_13 (Length: 240)
Name: NF2943_low_13
Description: NF2943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2943_low_13 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 11 - 240
Target Start/End: Complemental strand, 3206622 - 3206393
Alignment:
| Q |
11 |
atcatcatgattgatgggaatcgaaatttatgacaagttgcttcccttgaacaactttcgtgtgccgatgggacccttttttgtttcactgaacaagatc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3206622 |
atcatcatgattgatgggaatcgaaatttatgacaagttgcttcccttgcacaactttcgtgtgccgatgggacccttttttgtttcactgaacaagatc |
3206523 |
T |
|
| Q |
111 |
ttaaactacttttcattttgtggaatcacgaaggattttcagtcctttgctctaaccaactgagcttccagctcctttatgcagccttataccttactca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3206522 |
ttaaactacttttcattttgtggaatcacgaaggattttcagtcctttgctctaaccaactgagcttccagctcctgtatgcagccttataccttactca |
3206423 |
T |
|
| Q |
211 |
gtgaaacttaaatgtgagatacaattcacc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3206422 |
gtgaaacttaaatgtgagatacaattcacc |
3206393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 137 - 185
Target Start/End: Original strand, 24680323 - 24680370
Alignment:
| Q |
137 |
cacgaaggattttcagtcctttgctctaaccaactgagcttccagctcc |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
24680323 |
cacgaaggattttcagtcctttgctctaaccagctgagc-tccagctcc |
24680370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University