View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2947-Insertion-9 (Length: 136)
Name: NF2947-Insertion-9
Description: NF2947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2947-Insertion-9 |
| |
|
[»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 2e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 2e-65
Query Start/End: Original strand, 7 - 136
Target Start/End: Complemental strand, 3138525 - 3138396
Alignment:
Q |
7 |
aacttcactgaaaatgtaacttctagccgtggttttagcctgatgtggaaatggcaccgcaagccaaacataggctaattcgtatatagtttcggaagtt |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
3138525 |
aacttcactgaaaatgtaacttctagccgtggttttagcctgatgtggaaatggcaccgcaagccaaacataggctaattcgtatatagttttggaagtt |
3138426 |
T |
|
Q |
107 |
tttgtgtgtctaaatagcatagctggtata |
136 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
3138425 |
tttgtgtgtctaaatagcatagctggtata |
3138396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 32 - 82
Target Start/End: Original strand, 8382339 - 8382390
Alignment:
Q |
32 |
gccgtggttttagcctgatgtggaaatggcaccgca-agccaaacataggct |
82 |
Q |
|
|
|||||| |||| || ||||||||||||||||||||| ||||||||||||||| |
|
|
T |
8382339 |
gccgtgattttggcttgatgtggaaatggcaccgcacagccaaacataggct |
8382390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3304 times since January 2019
Visitors: 8726