View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2947-Insertion-9 (Length: 136)

Name: NF2947-Insertion-9
Description: NF2947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2947-Insertion-9
NF2947-Insertion-9
[»] chr1 (2 HSPs)
chr1 (7-136)||(3138396-3138525)
chr1 (32-82)||(8382339-8382390)


Alignment Details
Target: chr1 (Bit Score: 126; Significance: 2e-65; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 126; E-Value: 2e-65
Query Start/End: Original strand, 7 - 136
Target Start/End: Complemental strand, 3138525 - 3138396
Alignment:
7 aacttcactgaaaatgtaacttctagccgtggttttagcctgatgtggaaatggcaccgcaagccaaacataggctaattcgtatatagtttcggaagtt 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
3138525 aacttcactgaaaatgtaacttctagccgtggttttagcctgatgtggaaatggcaccgcaagccaaacataggctaattcgtatatagttttggaagtt 3138426  T
107 tttgtgtgtctaaatagcatagctggtata 136  Q
    ||||||||||||||||||||||||||||||    
3138425 tttgtgtgtctaaatagcatagctggtata 3138396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 32 - 82
Target Start/End: Original strand, 8382339 - 8382390
Alignment:
32 gccgtggttttagcctgatgtggaaatggcaccgca-agccaaacataggct 82  Q
    |||||| |||| || ||||||||||||||||||||| |||||||||||||||    
8382339 gccgtgattttggcttgatgtggaaatggcaccgcacagccaaacataggct 8382390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3304 times since January 2019
Visitors: 8726