View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2947R-Insertion-16 (Length: 116)
Name: NF2947R-Insertion-16
Description: NF2947R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2947R-Insertion-16 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 6e-44; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 6e-44
Query Start/End: Original strand, 15 - 116
Target Start/End: Original strand, 17507985 - 17508086
Alignment:
| Q |
15 |
aatatcaatatattatttcttctaatgcattgctaaacctttcaaagttttagtgaattccattctctttagctagggtttccttcttctcctctcttct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
17507985 |
aatatcaatatattatttcttctaatgcattgctaaacctttcaaagtcttagtgaattccattctctttagagagggtttccttcttctcctctcttct |
17508084 |
T |
|
| Q |
115 |
tt |
116 |
Q |
| |
|
|| |
|
|
| T |
17508085 |
tt |
17508086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 28; Significance: 0.0000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 77 - 116
Target Start/End: Complemental strand, 4539187 - 4539148
Alignment:
| Q |
77 |
ttctctttagctagggtttccttcttctcctctcttcttt |
116 |
Q |
| |
|
||||||| ||||||| ||| |||||||||||||||||||| |
|
|
| T |
4539187 |
ttctcttcagctaggcttttcttcttctcctctcttcttt |
4539148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University