View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2947R-Insertion-16 (Length: 116)

Name: NF2947R-Insertion-16
Description: NF2947R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2947R-Insertion-16
NF2947R-Insertion-16
[»] chr4 (1 HSPs)
chr4 (15-116)||(17507985-17508086)
[»] chr7 (1 HSPs)
chr7 (77-116)||(4539148-4539187)


Alignment Details
Target: chr4 (Bit Score: 90; Significance: 6e-44; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 90; E-Value: 6e-44
Query Start/End: Original strand, 15 - 116
Target Start/End: Original strand, 17507985 - 17508086
Alignment:
15 aatatcaatatattatttcttctaatgcattgctaaacctttcaaagttttagtgaattccattctctttagctagggtttccttcttctcctctcttct 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||  ||||||||||||||||||||||||||    
17507985 aatatcaatatattatttcttctaatgcattgctaaacctttcaaagtcttagtgaattccattctctttagagagggtttccttcttctcctctcttct 17508084  T
115 tt 116  Q
    ||    
17508085 tt 17508086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 28; Significance: 0.0000006; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 77 - 116
Target Start/End: Complemental strand, 4539187 - 4539148
Alignment:
77 ttctctttagctagggtttccttcttctcctctcttcttt 116  Q
    ||||||| ||||||| ||| ||||||||||||||||||||    
4539187 ttctcttcagctaggcttttcttcttctcctctcttcttt 4539148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University