View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2947_low_9 (Length: 240)
Name: NF2947_low_9
Description: NF2947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2947_low_9 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 17 - 240
Target Start/End: Complemental strand, 47365173 - 47364948
Alignment:
| Q |
17 |
aaaaaagtagtgcatgtttggaatcgcagtaagttagacgaacccacggtggcactgtgattttgttgaagcttgatactgtagctttcgacaaaatcac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47365173 |
aaaaaagtagtgcatgtttggaatcgcagtaagttagacgaacccacggtggcactgtgattttgttgaagcttgatactgtagctttcgacaaaatcac |
47365074 |
T |
 |
| Q |
117 |
tatgacacactgcaatgttgccaaactcattgccaaaataaacacttagtcaaataaacattacacctaccttctcttgagtggaatgtgtgt--cgtgt |
214 |
Q |
| |
|
|| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
47365073 |
tacgacacaccgcaatgttgccaaactcattgccaaaataaacacttagtcaaataaacattacacctaccttctcttgagtggaatgtatgtcccgtgt |
47364974 |
T |
 |
| Q |
215 |
aaagagcttctttaccatgctaaacc |
240 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
47364973 |
aaagagcttctttaccatgctaaacc |
47364948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 60 - 89
Target Start/End: Complemental strand, 38692840 - 38692811
Alignment:
| Q |
60 |
ccacggtggcactgtgattttgttgaagct |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38692840 |
ccacggtggcactgtgattttgttgaagct |
38692811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University