View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2948_high_1 (Length: 233)
Name: NF2948_high_1
Description: NF2948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2948_high_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 30774259 - 30774048
Alignment:
| Q |
1 |
atatgaagaagcttgaaaatatgttggaagaccttgaagtaaagactagatagttttctttttcagcagttaggttgttaagtgttgtcctgctatt--- |
97 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |||| || |
|
|
| T |
30774259 |
atatgaagaagcttgaaaatatgttgaaagaccttgaagtaaagactgaatagttttctttttcagcagttaggttgataagtgttgtcttgcttttgta |
30774160 |
T |
|
| Q |
98 |
-gtggtgaacggaaacttttatgatcgatgatggtctattatatgttatctactagttttgaaggttggacaaaatttgtagtgaccatgttatctaaga |
196 |
Q |
| |
|
|| ||||| |||||| ||||| ||||||| | |||||||| || |||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30774159 |
cgtcgtgaatggaaacctttat----gatgatgatttattatatattttctattagttttgaaggttggacaaaatttgctgtgaccatgttatctaaga |
30774064 |
T |
|
| Q |
197 |
ttgtgactgttcctga |
212 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
30774063 |
ttgtgactgttcctga |
30774048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 87
Target Start/End: Complemental strand, 8615703 - 8615635
Alignment:
| Q |
20 |
tatgttggaagaccttgaagtaaagacta-gatagttttctttttcagcagttaggttgttaagtgttg |
87 |
Q |
| |
|
||||||||||||||||| | | ||||||| | |||||| ||||||||||| |||| || |||||||||| |
|
|
| T |
8615703 |
tatgttggaagaccttgtatttaagactaagctagtttcctttttcagcaattagttttttaagtgttg |
8615635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University