View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2948_low_1 (Length: 457)
Name: NF2948_low_1
Description: NF2948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2948_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 15 - 366
Target Start/End: Complemental strand, 39895663 - 39895312
Alignment:
| Q |
15 |
atatcatcaaagtgaaagttgccatgagatttgcagtgacgagattcaagacgagtgaagagagaaccaaaagcaaagatcttatgaatagaagaagaat |
114 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39895663 |
atatcatcatagtgaaagttgccatgagatttgcagtgacgagattcaagacgagtgaagagagaaccaaaagcaaagatcttatgaatagaagaagaat |
39895564 |
T |
|
| Q |
115 |
tgggtggctttgtgtgtacggaactttgaagcttttgtgaactagcaacttttttggaggaagaagatgaagaagaacggtgattatgatggtggcgccg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39895563 |
tgggtggctttgtgtgtacggaactttgaagcttttgtgaactagcaacttttttggaggaagaagatgaagaagaacggtggttatgatggtggcgccg |
39895464 |
T |
|
| Q |
215 |
accttgttttgcagccaatagaagaagcctttcattcaagcataaaggacatacaccaacaactacttgtttagggtggaaattgcaacatggtttttca |
314 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39895463 |
accttgttttgctgccaatagaagaagcctttcattcaagcataaagggcatacaccaacaactacttgtttagggtggaaattgcaacatggtttttca |
39895364 |
T |
|
| Q |
315 |
tccctatatccattcctattcatgtttgttaataaaggtttttggtacacta |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39895363 |
tccctatatccattcctattcatgtttgttaataaaggtttttggtacacta |
39895312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University