View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2949_low_21 (Length: 227)
Name: NF2949_low_21
Description: NF2949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2949_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 17 - 208
Target Start/End: Complemental strand, 41885294 - 41885102
Alignment:
| Q |
17 |
gaagaaaatcatattacaaact-aaagtcattcaactggtccattttaactaagaacgtgagacaatataaacaatattggtcttcgtcttcctttacaa |
115 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41885294 |
gaagaaaatcatattacaaacttaaaatcattcaattggtccattgtaactaagaacgtgagacaatataaacaatattggtcttcgtcttcctttacaa |
41885195 |
T |
 |
| Q |
116 |
tgtgagacttgtttcaaagatttttcattttagcaatctacaccttaattgaaaattatatatcttttgctttcattgtctacgggtagttcg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41885194 |
tgtgagacttgtttcaaagatttttcattttagtaatctacaccttaattgaaaattatatatcttttgctttcattgtctacgggtagttcg |
41885102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University