View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2950_high_6 (Length: 342)

Name: NF2950_high_6
Description: NF2950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2950_high_6
NF2950_high_6
[»] chr8 (1 HSPs)
chr8 (17-334)||(4439470-4439787)
[»] chr4 (4 HSPs)
chr4 (188-327)||(8396321-8396460)
chr4 (17-117)||(8396524-8396624)
chr4 (206-324)||(8369007-8369125)
chr4 (45-117)||(8369217-8369289)


Alignment Details
Target: chr8 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 17 - 334
Target Start/End: Original strand, 4439470 - 4439787
Alignment:
17 atcctgtcatgcctccttaccaaaaccgctgttaccactggctgtctgtctcaccgatggcgacacctttggcaacatctccgtgtgctagatttctatg 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4439470 atcctgtcatgcctccttaccaaaaccgctgttaccactggctgtctgtctcaccgatggcgacacctttggcaacatctccgtgtgctagatttctatg 4439569  T
117 atgactccctctactctgataaccccatcgaactcaaaaagtttgtttttctggtgaccagggtgcttaccctccttcgtaatcctcgcggcattcggaa 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||    
4439570 atgactccctctactctgataaccccatcgaactcaaaaagtttgtttttctggtgaccggggtgcttaccctccttcctaatcctcgcggcattcggaa 4439669  T
217 gatgcgtctccactgtgctcattccgttatcaacgacgacaattttcatgatcattcacttgacacttgggtttgtcctgtcattgggccttaccttgag 316  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4439670 gatgcgtctccactgtgctcattccgttatcaacgacgacaattttcatgatcattcacttgacacttgggtttgtcctgtcattgggccttaccttgag 4439769  T
317 gaactcgaccttcatctc 334  Q
    |||||||||||| |||||    
4439770 gaactcgaccttgatctc 4439787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 56; Significance: 4e-23; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 188 - 327
Target Start/End: Complemental strand, 8396460 - 8396321
Alignment:
188 ctccttcgtaatcctcgcggcattcggaagatgcgtctccactgtgctcattccgttatcaacgacgacaattttcatgatcattcacttgacacttggg 287  Q
    ||||| ||||||||  ||||||||||||||||||||||  |||||||||| ||| ||||||||||| ||||||| | ||  | |||| |||||| |||||    
8396460 ctcctacgtaatcccagcggcattcggaagatgcgtcttaactgtgctcactccattatcaacgacaacaatttacgtgcccgttcagttgacagttggg 8396361  T
288 tttgtcctgtcattgggccttaccttgaggaactcgacct 327  Q
    || ||   |||||||||||| |||| ||||||||||||||    
8396360 ttcgtgtcgtcattgggcctcacctcgaggaactcgacct 8396321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 17 - 117
Target Start/End: Complemental strand, 8396624 - 8396524
Alignment:
17 atcctgtcatgcctccttaccaaaaccgctgttaccactggctgtctgtctcaccgatggcgacacctttggcaacatctccgtgtgctagatttctatg 116  Q
    |||||||||| |||||  ||||||||   |||| |||||||| |||| |||| |||||||| |||||||||| ||||||||| |||||||||||||||||    
8396624 atcctgtcatacctcccgaccaaaactattgtttccactggccgtctttctcgccgatggcaacacctttggaaacatctccatgtgctagatttctatg 8396525  T
117 a 117  Q
    |    
8396524 a 8396524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 206 - 324
Target Start/End: Complemental strand, 8369125 - 8369007
Alignment:
206 ggcattcggaagatgcgtctccactgtgctcattccgttatcaacgacgacaattttcatgatcattcacttgacacttgggtttgtcctgtcattgggc 305  Q
    ||||||||||| ||||||||   ||||||||| ||| || || | ||||||||||| | |   ||| || |||||||||||||| || ||||||||||||    
8369125 ggcattcggaaaatgcgtcttacctgtgctcactcccttgtcgatgacgacaatttccgttcccatacagttgacacttgggttcgttctgtcattgggc 8369026  T
306 cttaccttgaggaactcga 324  Q
    || | || |||||||||||    
8369025 ctcaactcgaggaactcga 8369007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 45 - 117
Target Start/End: Complemental strand, 8369289 - 8369217
Alignment:
45 ctgttaccactggctgtctgtctcaccgatggcgacacctttggcaacatctccgtgtgctagatttctatga 117  Q
    ||||| |||| ||| |||| |||| ||  |||| |||||||||| ||||||||| ||||||||||||| ||||    
8369289 ctgttgccaccggccgtctatctcgccagtggcaacacctttggaaacatctccatgtgctagatttcaatga 8369217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University