View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2950_high_8 (Length: 312)

Name: NF2950_high_8
Description: NF2950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2950_high_8
NF2950_high_8
[»] chr8 (1 HSPs)
chr8 (111-295)||(2648558-2648747)


Alignment Details
Target: chr8 (Bit Score: 145; Significance: 3e-76; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 111 - 295
Target Start/End: Complemental strand, 2648747 - 2648558
Alignment:
111 actactttatccatcgattcatattgtgattttagcgttgctttttgtgtatctgtgtgcattcatgtgtacaattatatgcataatcaagtttatgctt 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
2648747 actactttatccatcgattcatattgtgattttagcgttgctttttgtgtatctgtatgcattcatgtgtacaattatatgcataatcaagtttatgctt 2648648  T
211 tcaagtaatatagatatctgcattcattatatatgtgac---gtcgacaccgatgataa--tagagaaaaatgacaaaattcaatgtaat 295  Q
    |||||||||||||||||||||||||||||||||||||||   ||||||||| || ||||  |||| ||||||||||||||| ||||||||    
2648647 tcaagtaatatagatatctgcattcattatatatgtgacgtcgtcgacacctataataatttagaaaaaaatgacaaaatttaatgtaat 2648558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University