View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2950_low_10 (Length: 310)

Name: NF2950_low_10
Description: NF2950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2950_low_10
NF2950_low_10
[»] chr3 (1 HSPs)
chr3 (19-124)||(30936004-30936109)


Alignment Details
Target: chr3 (Bit Score: 86; Significance: 4e-41; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 19 - 124
Target Start/End: Complemental strand, 30936109 - 30936004
Alignment:
19 gcttttgccttggttgtgatttactccggcgacaaacgcctgctccttgtcaccggcaacctttttcaatctaggttgcatccgcctcagatcggcgtcg 118  Q
    ||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| ||||||||    
30936109 gcttttggcttggttgtgatttacttcggcgacaaacgcctgctccttgtcaccgacaacctttttcgatctaggttgcatccgcctcagaccggcgtcg 30936010  T
119 ctgtcc 124  Q
    ||||||    
30936009 ctgtcc 30936004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University