View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2950_low_10 (Length: 310)
Name: NF2950_low_10
Description: NF2950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2950_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 86; Significance: 4e-41; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 19 - 124
Target Start/End: Complemental strand, 30936109 - 30936004
Alignment:
| Q |
19 |
gcttttgccttggttgtgatttactccggcgacaaacgcctgctccttgtcaccggcaacctttttcaatctaggttgcatccgcctcagatcggcgtcg |
118 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
30936109 |
gcttttggcttggttgtgatttacttcggcgacaaacgcctgctccttgtcaccgacaacctttttcgatctaggttgcatccgcctcagaccggcgtcg |
30936010 |
T |
|
| Q |
119 |
ctgtcc |
124 |
Q |
| |
|
|||||| |
|
|
| T |
30936009 |
ctgtcc |
30936004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University