View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2950_low_17 (Length: 230)

Name: NF2950_low_17
Description: NF2950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2950_low_17
NF2950_low_17
[»] chr1 (2 HSPs)
chr1 (1-157)||(46643301-46643457)
chr1 (178-215)||(46643472-46643509)


Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 46643301 - 46643457
Alignment:
1 taagttggatgataaggatgatacaaagaattgtattcctcatatgcatttccaaagatcgagtcatgggtgtgatgctttttatgaacatcctgttcat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46643301 taagttggatgataaggatgatacaaagaattgtattcctcatatgcatttccaaagatcgagtcatgggtgtgatgctttttatgaacatcctgttcat 46643400  T
101 tgtactggtgttggttgttcttttgtaactctaccgccaacaccaccttcttgtcca 157  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
46643401 tgtactggtgttggttgttcttttgtaactctaccgccaccaccaccttcttgtcca 46643457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 178 - 215
Target Start/End: Original strand, 46643472 - 46643509
Alignment:
178 ggcagcttaccaccattatctctgatgagataagagct 215  Q
    ||||||||||||||||||||||||||||||||||||||    
46643472 ggcagcttaccaccattatctctgatgagataagagct 46643509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University