View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2950_low_17 (Length: 230)
Name: NF2950_low_17
Description: NF2950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2950_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 46643301 - 46643457
Alignment:
| Q |
1 |
taagttggatgataaggatgatacaaagaattgtattcctcatatgcatttccaaagatcgagtcatgggtgtgatgctttttatgaacatcctgttcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46643301 |
taagttggatgataaggatgatacaaagaattgtattcctcatatgcatttccaaagatcgagtcatgggtgtgatgctttttatgaacatcctgttcat |
46643400 |
T |
 |
| Q |
101 |
tgtactggtgttggttgttcttttgtaactctaccgccaacaccaccttcttgtcca |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46643401 |
tgtactggtgttggttgttcttttgtaactctaccgccaccaccaccttcttgtcca |
46643457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 178 - 215
Target Start/End: Original strand, 46643472 - 46643509
Alignment:
| Q |
178 |
ggcagcttaccaccattatctctgatgagataagagct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46643472 |
ggcagcttaccaccattatctctgatgagataagagct |
46643509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University