View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2950_low_9 (Length: 312)
Name: NF2950_low_9
Description: NF2950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2950_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 3e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 111 - 295
Target Start/End: Complemental strand, 2648747 - 2648558
Alignment:
| Q |
111 |
actactttatccatcgattcatattgtgattttagcgttgctttttgtgtatctgtgtgcattcatgtgtacaattatatgcataatcaagtttatgctt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2648747 |
actactttatccatcgattcatattgtgattttagcgttgctttttgtgtatctgtatgcattcatgtgtacaattatatgcataatcaagtttatgctt |
2648648 |
T |
 |
| Q |
211 |
tcaagtaatatagatatctgcattcattatatatgtgac---gtcgacaccgatgataa--tagagaaaaatgacaaaattcaatgtaat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| || |||| |||| ||||||||||||||| |||||||| |
|
|
| T |
2648647 |
tcaagtaatatagatatctgcattcattatatatgtgacgtcgtcgacacctataataatttagaaaaaaatgacaaaatttaatgtaat |
2648558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University