View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2951_high_14 (Length: 328)
Name: NF2951_high_14
Description: NF2951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2951_high_14 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 295; Significance: 1e-166; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 18 - 328
Target Start/End: Complemental strand, 55097156 - 55096846
Alignment:
| Q |
18 |
gtgaaaaaatcggatgtcccgttgccgacttgaggattagtctcatagaggattcaaatggtttaagccgtaattataccttggagcgcttaatggatgt |
117 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55097156 |
gtgaaaaaatcggatgtcccgctgccgacttgaggattagtatcatagaggattcaaatggtttaagccgtaattataccttggagcgcttaatggatgt |
55097057 |
T |
|
| Q |
118 |
caaagatcgtagttacacccggcaacatatatagcctcttcattagcatgaatttgtaaacttgtttttgaatgtgatggagaagcaagtaaaagatagt |
217 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55097056 |
caaagatcgtagttacactcggcaacatatatagcctcttcattagcatgaatttgtaaacttgtttttgaatgtgatggagaagcaagtaaaagatagt |
55096957 |
T |
|
| Q |
218 |
attgcattgaagactagaggaaatgcatttgttattcaactcaaaatggggaaacttattttgcctgtcacacttgcagcataaactgttacctgaaaca |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55096956 |
attgcattgaagactagaggaaatgcatttgttattcaactcaaaatggggaaacttattttgcctgtcacacttgcagcataaactgttacctgaaaca |
55096857 |
T |
|
| Q |
318 |
ttcttcatctc |
328 |
Q |
| |
|
|||||| |||| |
|
|
| T |
55096856 |
ttcttcttctc |
55096846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 208 - 308
Target Start/End: Complemental strand, 34858516 - 34858416
Alignment:
| Q |
208 |
aaaagatagtattgcattgaagactagaggaaatgcatttgttattcaactcaaaatggggaaacttattttgcctgtcacacttgcagcataaactgtt |
307 |
Q |
| |
|
|||||||||| ||||||||||||||| || |||| || ||||| ||| |||||| |||||| ||||||| |||| ||||||| |||||||||||| |
|
|
| T |
34858516 |
aaaagatagttatgcattgaagactagctgaggtgcaatttttattaaacccaaaatagggaaaattatttttcctggtacacttgtggcataaactgtt |
34858417 |
T |
|
| Q |
308 |
a |
308 |
Q |
| |
|
| |
|
|
| T |
34858416 |
a |
34858416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 18 - 65
Target Start/End: Complemental strand, 27491515 - 27491468
Alignment:
| Q |
18 |
gtgaaaaaatcggatgtcccgttgccgacttgaggattagtctcatag |
65 |
Q |
| |
|
||||||||||||||||| ||| |||| ||| ||||||||||||||||| |
|
|
| T |
27491515 |
gtgaaaaaatcggatgttccgctgccaactcgaggattagtctcatag |
27491468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University