View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2951_high_26 (Length: 240)
Name: NF2951_high_26
Description: NF2951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2951_high_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 38484947 - 38484726
Alignment:
| Q |
1 |
acaatgaagcaatgcccttaaaaacttaccatttaccttaatttaaagtgaaatgaatcacattcatgtctaattttatgtacatgcatccaattttgtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
38484947 |
acaatgaagcaatgcccttaaaaacttaccatttaccttaatttaaagtgaaatgaatctcattcatgtctaattttatgtacatgcatccaattttcag |
38484848 |
T |
 |
| Q |
101 |
agtaactactattac-nnnnnnnaggggatgagtaaaactgtaaaaggattgggaaagatgaatgtgattgtgaatgcacgtgaacgtagaggggctgaa |
199 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38484847 |
agtaactactattacttttttttaggggatgagtaaaactgtaaaaggattgggaaagataaatgtgattgtgaatgcacgtgaacgtagaggggctgaa |
38484748 |
T |
 |
| Q |
200 |
gttgatccatccatataaccct |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
38484747 |
gttgatccatccatataaccct |
38484726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University