View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2951_low_33 (Length: 233)
Name: NF2951_low_33
Description: NF2951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2951_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 14 - 216
Target Start/End: Complemental strand, 25841612 - 25841410
Alignment:
| Q |
14 |
cagagacaaatggcaagagatcaaagggaattagccagacaaagaaatataaaaatagagaaggaggcaattgaaaaggagaagaataacaaacttagac |
113 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25841612 |
cagagacaaattgcaagagatcaaagggaattagccagacaaagaaatataaaaatagagaaggaggcaattgaaaaggagaagaataacaaacttagac |
25841513 |
T |
 |
| Q |
114 |
cattgcaattccaaaagaagaagattgaagacgacacggaggccaaactcagaccgttacaaattcaaaagcagaagattgaagacgatgctaaagtcaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
25841512 |
cattgcaattccaaaagaagaagattgaagacgacacggaggccaaactcagaccgttgcagattcaaaagcagaagattgaagacgacgctaaagtcaa |
25841413 |
T |
 |
| Q |
214 |
act |
216 |
Q |
| |
|
||| |
|
|
| T |
25841412 |
act |
25841410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University