View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2951_low_35 (Length: 223)
Name: NF2951_low_35
Description: NF2951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2951_low_35 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 19 - 166
Target Start/End: Original strand, 40280860 - 40281007
Alignment:
| Q |
19 |
atgatgcctgttagagtgagcgtgtaagccatgatgcatcatcaagcgcatcgccatgg-tgttcatcatttctgagactgagttggttttgtttctttt |
117 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||||||||||| |||||| |||||| |||| ||||| ||| ||||| |||||||||||||||||| |
|
|
| T |
40280860 |
atgatggctgtgagagtgagcgtgtaagccatgatgcatcatcaaacgcatcaccatggttgttaatcatctctaagact--gttggttttgtttctttt |
40280957 |
T |
|
| Q |
118 |
ctgaattagtaagacttattagggc-aaggccgcaagaaactgaatgaaa |
166 |
Q |
| |
|
|||||| |||||||||||||||||| |||| ||||||||||||| |||| |
|
|
| T |
40280958 |
ctgaatcagtaagacttattagggcaaaggtagcaagaaactgaaagaaa |
40281007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University