View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2952_low_7 (Length: 248)
Name: NF2952_low_7
Description: NF2952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2952_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 32 - 231
Target Start/End: Original strand, 32966579 - 32966779
Alignment:
| Q |
32 |
tgtgtaaaattttacattaatcattaatataaatacataagcataactatacaatcggaaaggacttgatcattcataattaataattaataatgaagga |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32966579 |
tgtgtaaaattttacattaatcattaatataaatacataagcataactatacaatcggaaaggacttgatcattcataattaataattaataatgaagga |
32966678 |
T |
 |
| Q |
132 |
gaattcaaatatttccgttgtct-tttaagaggggtttctattttgtagggcagcatgaagagtacttttctttctttcaagtaagttttgtccctttct |
230 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32966679 |
gaattcaaatatttccgttgtgtctttaagaggggtttctattttgtagggcagcatgaagagtacttttctttctttcaagtaagttttgtccctttct |
32966778 |
T |
 |
| Q |
231 |
t |
231 |
Q |
| |
|
| |
|
|
| T |
32966779 |
t |
32966779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University