View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2953_high_3 (Length: 201)

Name: NF2953_high_3
Description: NF2953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2953_high_3
NF2953_high_3
[»] chr5 (1 HSPs)
chr5 (1-184)||(43327208-43327388)


Alignment Details
Target: chr5 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 184
Target Start/End: Complemental strand, 43327388 - 43327208
Alignment:
1 caacatgttcataagaagattaataatagtgatgatgatgatgataataagatcatcatcaagtgggttgctttggcagatgggatggaagaggacagta 100  Q
    |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||   |||||||||||||||||||||||||||||||||||||||    
43327388 caacatgttcataagaagattaataataatgatgatgatgatgatgataggatcatca---agtgggttgctttggcagatgggatggaagaggacagta 43327292  T
101 caacaccagatttctttgccattgaatcatccatggagagtataatgccaaaccattttgaagagtttcttcaaaatcaaaatc 184  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43327291 caacaccagatttctttgccattgaatcatccatggagagtataatgccaaaccattttgaagagtttcttcaaaatcaaaatc 43327208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University