View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2954_high_4 (Length: 298)
Name: NF2954_high_4
Description: NF2954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2954_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 5 - 284
Target Start/End: Complemental strand, 44344244 - 44343951
Alignment:
| Q |
5 |
ttgtaagtaacaatgcattgtcttacttatcaaataatttctatcttgaattttgaattgatgattgtcattgtctctcaaatgcacgcatgcatgcatg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44344244 |
ttgtaagtaacaatgcattgtcttacttatcaaataatttctatcttgaattttgaattgatgattgtcattgtctctcaaatgcacgcatgcatgcatg |
44344145 |
T |
 |
| Q |
105 |
cattatatatattcttaaatttagctatcataataaaatgtggtacactaactcaggaactaattgctaattaattaacctttgatcagtgaaaagaaga |
204 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44344144 |
cattatat----tcttaaatttagctatcataataaaatgtggtacactaactaaggaactaattgctaattaattaacctttgatcagtgaaaagaaga |
44344049 |
T |
 |
| Q |
205 |
tgtctggtgtatctgt------------------agcaccacaaactccaggcataaaagcaaaccagcgatcagaagcaccttctgcaggtggaatg |
284 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44344048 |
tgtctggtgtatctgtagcaacagctcctccaacagcaccacaaactccaggcacaaaagcaaaccagcgatcagaagcaccttctgcaggtggaatg |
44343951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University