View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2954_low_2 (Length: 353)
Name: NF2954_low_2
Description: NF2954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2954_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 141 - 343
Target Start/End: Original strand, 44344383 - 44344585
Alignment:
| Q |
141 |
agatgtatgttagtttttatacttacaagtgaaaatgaaatgatgagaagagaagaggaagaattgttggttcnnnnnnnngaaaggcgttggagtagga |
240 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44344383 |
agatgtaggttagtttttttacttacaagtgaaaatgaaatgatgagaagagaagaggaagaattgttggttcaaaaaaaagaaaggcgttggagtagga |
44344482 |
T |
|
| Q |
241 |
gtttgtgatgatccaaaatttggtgaagaaaagataaaccattggaacgtgtaatgtagcatgcacaacacttgtttctcttccatgtcgtcaatgacct |
340 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44344483 |
gtttgtgatgatccaaaatttggtgaacaaaagataaaccattggaacgtgtaatgtagcatgcacaacacttgtttctcttccatgtcgtcaatgacct |
44344582 |
T |
|
| Q |
341 |
atg |
343 |
Q |
| |
|
||| |
|
|
| T |
44344583 |
atg |
44344585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 17 - 72
Target Start/End: Original strand, 44344261 - 44344316
Alignment:
| Q |
17 |
gtgatgaaaatgagaaattgagaaggaaaattcagattattattattgctgggatt |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44344261 |
gtgatgaaaatgagaaattgagaaggaaaattcagattattattattgctgggatt |
44344316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University