View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2954_low_3 (Length: 335)

Name: NF2954_low_3
Description: NF2954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2954_low_3
NF2954_low_3
[»] chr2 (1 HSPs)
chr2 (133-237)||(162576-162680)


Alignment Details
Target: chr2 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 133 - 237
Target Start/End: Complemental strand, 162680 - 162576
Alignment:
133 aggagaaggaggggattggggttcttcttttgtatgataatttcatttcctagccaaataatctccggacgaccatcgtcgtcatcatcaacgtcttctt 232  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
162680 aggagaaggaggggattggggttcttcttttgtatgataatttcatttcctagccaaataatctccggacgaccatcgtcgtcatcatcaacgtcttctt 162581  T
233 cttct 237  Q
    |||||    
162580 cttct 162576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University