View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2954_low_3 (Length: 335)
Name: NF2954_low_3
Description: NF2954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2954_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 133 - 237
Target Start/End: Complemental strand, 162680 - 162576
Alignment:
| Q |
133 |
aggagaaggaggggattggggttcttcttttgtatgataatttcatttcctagccaaataatctccggacgaccatcgtcgtcatcatcaacgtcttctt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
162680 |
aggagaaggaggggattggggttcttcttttgtatgataatttcatttcctagccaaataatctccggacgaccatcgtcgtcatcatcaacgtcttctt |
162581 |
T |
 |
| Q |
233 |
cttct |
237 |
Q |
| |
|
||||| |
|
|
| T |
162580 |
cttct |
162576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University