View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2955_low_3 (Length: 250)
Name: NF2955_low_3
Description: NF2955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2955_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 10604815 - 10604570
Alignment:
| Q |
1 |
attctttttctatgctagctataatattttaatttaatgtttattgatcatcaacttattatgttttgttgcatcttcttttacagaaaaattaggccaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10604815 |
attctttttctatgctagctataatattttaatttaatgtttattgatcatcaacttatactgttttgttgcatcttcttttacagaaaaattaggccaa |
10604716 |
T |
 |
| Q |
101 |
agatgacactccctatctttttgaggctagcggttcttggtttccttgagtaaggctcttcaattcctctcctccatttaattatcactatattcttggg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10604715 |
agatgacactccctatctttttgaggctagcggttcttggtttccttgagtaaggctcttcaattcctctcctccatttaattatcactatattcttggg |
10604616 |
T |
 |
| Q |
201 |
tatatcgaatcctacattttgtcggtatattagtttcatctctctc |
246 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||| || |||||| |
|
|
| T |
10604615 |
tatatcgaatcctacattttgtctgtttattagttttatgtctctc |
10604570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 80 - 161
Target Start/End: Complemental strand, 32604369 - 32604288
Alignment:
| Q |
80 |
tttacagaaaaattaggccaaagatgacactccctatctttttgaggctagcggttcttggtttccttgagtaaggctcttc |
161 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||| ||||| ||||| ||| || |||||||||||||||||||||||||| |
|
|
| T |
32604369 |
tttacagaaaaacaaggccaaagatgactctccccatcttcctgaggatagtggcacttggtttccttgagtaaggctcttc |
32604288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University