View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2956_high_2 (Length: 299)
Name: NF2956_high_2
Description: NF2956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2956_high_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 28 - 284
Target Start/End: Complemental strand, 33010358 - 33010101
Alignment:
| Q |
28 |
ggatgtctaaatttatcccggtgatcttatttttcaactagtcctgaaaccacgtttactactacttgtataacatgaaaaattatgtagagttgttgat |
127 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33010358 |
ggatgtccgaatttttcccggtgatcttatttttcaactagccctgaaaccacgtttactactacttgtataacatgaaaaattatgcagagttgttgat |
33010259 |
T |
 |
| Q |
128 |
ttttcatgtat-ttttctgaattttctcacgttttctcgatgtttctgagatggaaagacatgttgatgcgtttgggaggataaagtctcagccattgtc |
226 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33010258 |
ttttcatgtatgttttttgaattttctcacgttttctcgatgtttctgagatggaaagacatgttgatgcgtttgggaggataaagtctcagccattgtc |
33010159 |
T |
 |
| Q |
227 |
tttgttaggcaagagcggatggcgaaatgcagagctgaaaaggcgaaccctctcaacc |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33010158 |
tttgttaggcaagagcggatggcgaaatgcagagctgaaaaggcgaaccctctcaacc |
33010101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University