View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2958_high_5 (Length: 251)
Name: NF2958_high_5
Description: NF2958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2958_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 18 - 250
Target Start/End: Complemental strand, 16097553 - 16097319
Alignment:
| Q |
18 |
cagccaatgtcactgaggaccaaaagaaacttaggcggtttgcttttacattaatagggagagccaaggaatggttattgtctctgccaagtgtaaccat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16097553 |
cagccaatgtcactgaggaccaaaagaaacttaggcggtttgcttttacattaatagggagagccaaggaatggttattgtctctgccaagtgtaaccat |
16097454 |
T |
 |
| Q |
118 |
acagacttgagagg--ttataacttaagtttcttcaagaggtttttcctatgtcaaagtattgggagaaaagacatgagctcacaaattttatgcaaggt |
215 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16097453 |
acagacttgagaggagttataacttaagtttcttcaagaggtttttcctatgtcaaagtattgggagaaaagacatgagctcacaaattttatgcaaggt |
16097354 |
T |
 |
| Q |
216 |
gacggtgaatctctctatgatgcgtgggagaggtt |
250 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
16097353 |
gacggtgaatctctctatgatgcttgggagaggtt |
16097319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University