View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2958_high_7 (Length: 249)
Name: NF2958_high_7
Description: NF2958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2958_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 169
Target Start/End: Complemental strand, 4329094 - 4328926
Alignment:
| Q |
1 |
ttagctacagagttattcattctagtactttacattccagtaaaccataattcagtttttaaagtatatgaacattacaaataattgttaaagtatgtac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4329094 |
ttagctacagagttattcattctagtactttacattccagtaaaccataattctgtttttaaagtatatgaacataacaaataattgttaaagtatgtac |
4328995 |
T |
 |
| Q |
101 |
aatttatcttgttctctaaagtatatgaaaattcattatgttaatccctagtaggaactatactttaga |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4328994 |
aatttatcttgttctctaaagtatatgaaaattcattatgttattccctagtaggaactatactttaga |
4328926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 159 - 228
Target Start/End: Complemental strand, 4328912 - 4328843
Alignment:
| Q |
159 |
tatactttagagactaaatgagagagagattggactataatgttgatcaagtagaagcaatttgacccca |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||| |
|
|
| T |
4328912 |
tatactttagagactaaatgagagagagattggactataatgttggtcaggtagaagcaatttgccccca |
4328843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University