View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2958_low_7 (Length: 288)
Name: NF2958_low_7
Description: NF2958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2958_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 266; Significance: 1e-148; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 1 - 270
Target Start/End: Original strand, 456364 - 456633
Alignment:
| Q |
1 |
atgaagtgaaaaaagggtagagttgatatctaacattacaagaaggaagcaaagctcttgcaccctgttttccattaggaatagttccaatagcattttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
456364 |
atgaagtgaaaaaagggtagagttgatatctaacattacaagaaggaagcaaagctcttgcaccctgttttccattaggaatagttccaatagcattttt |
456463 |
T |
 |
| Q |
101 |
caaacacgtcccacattcactattcgttaagtcattcgtgcactgcatcaatccatacaccgtcatggactccgtcaccactacttcaccggcagcaaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
456464 |
caaacacgtcccacattcactattcgttaagtcattcgtgcactgcatcaatccatacaccgtcatggactccgtcaccactacttcaccggcggcaaac |
456563 |
T |
 |
| Q |
201 |
ttcttcgactcagaactcccggaggcttctgttgccaaatcattcaacaacccatgcagagattggttga |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
456564 |
ttcttcgactcagaactcccggaggcttctgttgccaaatcattcaacaacccatgcagagattggttga |
456633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 66
Target Start/End: Original strand, 473610 - 473666
Alignment:
| Q |
10 |
aaaaagggtagagttgatatctaacattacaagaaggaagcaaagctcttgcaccct |
66 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||| ||||||||| |||||||||| |
|
|
| T |
473610 |
aaaacgggtagagttgatatctaacaatacaagaagcaagcaaagcacttgcaccct |
473666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University