View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2960_high_11 (Length: 347)
Name: NF2960_high_11
Description: NF2960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2960_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 19 - 336
Target Start/End: Complemental strand, 44694905 - 44694588
Alignment:
| Q |
19 |
ggaactacagtacttgaatagattcactgggattactggatgcattggattattaggaaacgaagaaggagcatatgaccctgttgtaaaattatcaggc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44694905 |
ggaactacagtacttgaatagattcactgggattactggatgcattggattattaggaaacgaagaaggagcatatgaccctgttgtaaaattatcaggc |
44694806 |
T |
|
| Q |
119 |
cttttaggaacaagcattctgtccctgggagccaatgttgccttgcacataccaacaagatcaataaccaagttgactgctggcttcggcttaaacactg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44694805 |
cttttaggaacaagcattctgtccctgggagccaatgttgccttgcacataccaacaagatcaataaccaagttgactgctggcttcggcttaaacactg |
44694706 |
T |
|
| Q |
219 |
ccttccttgaagcttcattgaccttgtaagatatatccatcaaaaactactggtgatctataaactaactttaggatgtaattaatcgttactgcttagt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44694705 |
ccttccttgaagcttcattgaccttgtaagatatatccatcaaaaactactggtgatctataaactaactttaggatgtaattaatcgttactgcttagt |
44694606 |
T |
|
| Q |
319 |
gttctgctactgtttctt |
336 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
44694605 |
gttctgctactgtttctt |
44694588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University