View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2960_high_20 (Length: 246)

Name: NF2960_high_20
Description: NF2960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2960_high_20
NF2960_high_20
[»] chr8 (2 HSPs)
chr8 (133-232)||(34175418-34175517)
chr8 (13-74)||(34175285-34175346)


Alignment Details
Target: chr8 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 133 - 232
Target Start/End: Original strand, 34175418 - 34175517
Alignment:
133 taatcaaattttattaaaaccacatacacctcaatacctcataggacaggtaaggttacggaggtgccaaaagatagaaacaaaatgaaaatattatact 232  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
34175418 taatcaaattttattaaaaccacatacacctcaatacctcataggagaggtaaggttacggaggtgccaaaagatagaaacaaaatgaaaatattatact 34175517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 13 - 74
Target Start/End: Original strand, 34175285 - 34175346
Alignment:
13 tgaatgcctgtcataattagtgaatcaagttgatgaatggaatgagatgtgatgagaggagc 74  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34175285 tgaatgcctgtcataattagtgaatcaagttgatgaatggaatgagatgtgatgagaggagc 34175346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University