View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2960_high_8 (Length: 363)
Name: NF2960_high_8
Description: NF2960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2960_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 11 - 263
Target Start/End: Complemental strand, 8274832 - 8274580
Alignment:
| Q |
11 |
cagagactaataaaatgagtcacatgtaaagggaccnnnnnnncagtcctgttttagacttggtttgtctctctttcctatatctcgaggagatggatta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8274832 |
cagagactaataaaatgagtcacatgtaaagggaccaaaaacacagtcctgttttagacttggtttgtctctctttcctatatctcgaggagatggatta |
8274733 |
T |
|
| Q |
111 |
gattggatgaggaacaagacgaaattgtacattatcaaaacaagagggatctttctttaggacaaataataatttatttttataaaaaatatgaataaga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8274732 |
gattggatgaggaacaagacgaaattgtacattatcaaaagaagagggatctttctttaggacaaataataatttatttttataaaaaataagaataaga |
8274633 |
T |
|
| Q |
211 |
taagaaacagcatcatcatcatggaattggatggctgtcaatgtcctagacta |
263 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8274632 |
taagaaatagcatcatcatcatggaattggatggctgtcaatgtcctagacta |
8274580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 282 - 323
Target Start/End: Complemental strand, 8274591 - 8274550
Alignment:
| Q |
282 |
tgtcctagactaatagctcacacataggatgatatagaattc |
323 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8274591 |
tgtcctagactaattgctcacacataggatgatatagaattc |
8274550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University