View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2960_low_14 (Length: 280)
Name: NF2960_low_14
Description: NF2960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2960_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 3e-66; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 90 - 266
Target Start/End: Original strand, 55016200 - 55016376
Alignment:
| Q |
90 |
atttactttttaatttcacttttagatccttatcttgagttaacattttccatatttaaaagaagagtgtcgctatatctcccgataaaatgtgtctcga |
189 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| ||||||||||| ||||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
55016200 |
atttactttttaattccacttttaaatccttatcttaagttaacatttcccatatttaaaagaagagtgtcgttatatgtcccgataaaatgtgtctcga |
55016299 |
T |
 |
| Q |
190 |
gcggatcgcaaaacaacacttaaccaatggggcagtttgnnnnnnnatgatacatggagtagctatcgtgaagtttt |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
55016300 |
gcggatcgcaaaacaacacttaaccaatgggacagtttgtttttttatgatacatggagtagctatcgtgaagtttt |
55016376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 11 - 94
Target Start/End: Original strand, 55015996 - 55016079
Alignment:
| Q |
11 |
aatggatgtggccctgcaggctagctctcatgagttttgtgtctttaaaaataaacttaaatacaattttgctccttatattta |
94 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55015996 |
aatggctgtggccctgcaggctagcactcatgagttttgagtctttaaaaataaacttaaatacaattttgctccttatattta |
55016079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 90 - 126
Target Start/End: Original strand, 50164078 - 50164114
Alignment:
| Q |
90 |
atttactttttaatttcacttttagatccttatcttg |
126 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
50164078 |
atttattttttaattccacttttagatccttatcttg |
50164114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 90 - 125
Target Start/End: Original strand, 32546513 - 32546548
Alignment:
| Q |
90 |
atttactttttaatttcacttttagatccttatctt |
125 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32546513 |
atttattttttaatttcacttttagatccttatctt |
32546548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 96 - 126
Target Start/End: Complemental strand, 30269280 - 30269250
Alignment:
| Q |
96 |
tttttaatttcacttttagatccttatcttg |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
30269280 |
tttttaatttcacttttagatccttatcttg |
30269250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 236 - 266
Target Start/End: Complemental strand, 42453332 - 42453302
Alignment:
| Q |
236 |
atgatacatggagtagctatcgtgaagtttt |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
42453332 |
atgatacatggagtagctatcgtgaagtttt |
42453302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University