View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2960_low_21 (Length: 246)
Name: NF2960_low_21
Description: NF2960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2960_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 133 - 232
Target Start/End: Original strand, 34175418 - 34175517
Alignment:
| Q |
133 |
taatcaaattttattaaaaccacatacacctcaatacctcataggacaggtaaggttacggaggtgccaaaagatagaaacaaaatgaaaatattatact |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34175418 |
taatcaaattttattaaaaccacatacacctcaatacctcataggagaggtaaggttacggaggtgccaaaagatagaaacaaaatgaaaatattatact |
34175517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 13 - 74
Target Start/End: Original strand, 34175285 - 34175346
Alignment:
| Q |
13 |
tgaatgcctgtcataattagtgaatcaagttgatgaatggaatgagatgtgatgagaggagc |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34175285 |
tgaatgcctgtcataattagtgaatcaagttgatgaatggaatgagatgtgatgagaggagc |
34175346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University