View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2961R-Insertion-7 (Length: 260)
Name: NF2961R-Insertion-7
Description: NF2961R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2961R-Insertion-7 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 9 - 260
Target Start/End: Original strand, 43767376 - 43767627
Alignment:
| Q |
9 |
gtaaatgttttagtggacnnnnnnnngattaagttgattgtagtagaattatatgtttttgattatagtatggtttcttaacacatgcattaatctttct |
108 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43767376 |
gtaaatgttttagtggacaaaaaaaagattaagttgattgtagtagaattatatgtttttgattatagtatggtttcttaacacatgcattaatctttct |
43767475 |
T |
 |
| Q |
109 |
ttttagaagtgaaggttgttgtcaacttttaagctcctttgcttatctatttcacagaaatatagataaagacacataaaatataaaaagttcaatgtca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43767476 |
ttttagaagtgaaggttgttgtcaacttttaagctcctttgcttatctatttcacataaatatagataaagacacataaaatataaaaagttcaatgtca |
43767575 |
T |
 |
| Q |
209 |
tttaaactttagtaacacttggaactttcctctcctccatgtcttgtctaat |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43767576 |
tttaaactttagtaacacttggaactttcctctcctccatgtcttgtctaat |
43767627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University