View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2961_high_17 (Length: 238)
Name: NF2961_high_17
Description: NF2961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2961_high_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 228
Target Start/End: Complemental strand, 36465246 - 36465036
Alignment:
| Q |
18 |
tggtgaaggcatggttacaggtggagcaggagcaactgttttatacaacttgaggcaaagacatccaacacttgacctgcctgtgattgactatgattta |
117 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36465246 |
tggtgaaggcatgattacaggtggagcaggagcaactgttttatacaacttgaggcaaagacacccaacacttgacctgcctgtgattgactatgattta |
36465147 |
T |
|
| Q |
118 |
gcacttctttttcaaccaatgttaatgcttggaatcagtcttggtgttgcttttaatgtcatttttcctgactggatgataacatctttgatactaatat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36465146 |
gcacttctttttcaaccaatgttaatgcttggaatcagtcttggtgttgcttttaatgtcatttttcctgactggatgataacatctttgatactaatat |
36465047 |
T |
|
| Q |
218 |
ttttcacaggt |
228 |
Q |
| |
|
||||||||||| |
|
|
| T |
36465046 |
ttttcacaggt |
36465036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 20 - 224
Target Start/End: Complemental strand, 36474422 - 36474218
Alignment:
| Q |
20 |
gtgaaggcatggttacaggtggagcaggagcaactgttttatacaacttgaggcaaagacatccaacacttgacctgcctgtgattgactatgatttagc |
119 |
Q |
| |
|
|||||| |||| |||| |||||||||||||||||||||||||||||||||| | ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36474422 |
gtgaagtcatgattactggtggagcaggagcaactgttttatacaacttgaagaaaagacacccaacacttgacctgcctgtgattgactatgatttagc |
36474323 |
T |
|
| Q |
120 |
acttctttttcaaccaatgttaatgcttggaatcagtcttggtgttgcttttaatgtcatttttcctgactggatgataacatctttgatactaatattt |
219 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |||||||||||| ||||| ||||| || | |||||| |
|
|
| T |
36474322 |
acttcttttccaaccaatgttaatgcttggaatcagtcttggtgttgctttcaatctcattttccctgactggatgttaacaactttgctaatcatattt |
36474223 |
T |
|
| Q |
220 |
ttcac |
224 |
Q |
| |
|
||||| |
|
|
| T |
36474222 |
ttcac |
36474218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University