View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2961_high_19 (Length: 208)
Name: NF2961_high_19
Description: NF2961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2961_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 18 - 194
Target Start/End: Original strand, 44946922 - 44947098
Alignment:
| Q |
18 |
caattgggactagagatggtttacttgaggcataatccatccatagcttataaaaaatattaggttctatgaatattttgattccctcttattttttcag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44946922 |
caattgggactagagatggtttacttgaggcataatccatccatagcttataaaaaatattaggttctatgaatattttgattccctcttattttttcag |
44947021 |
T |
 |
| Q |
118 |
tgggtagttggtgagtagaagatattaatcattgtataatcttcttttccaaaccgaacacattatcatgttcagtg |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44947022 |
tgggtagttggtgagtagaagatattaatctttgtataatcttcttttccaaaccgaacacattatcatgttcagtg |
44947098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 146 - 194
Target Start/End: Complemental strand, 11451681 - 11451633
Alignment:
| Q |
146 |
tcattgtataatcttcttttccaaaccgaacacattatcatgttcagtg |
194 |
Q |
| |
|
||||| |||||||||||||||||||| |||| ||||||| |||||||| |
|
|
| T |
11451681 |
tcattatataatcttcttttccaaactgaactcattatccagttcagtg |
11451633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University