View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2961_high_8 (Length: 345)
Name: NF2961_high_8
Description: NF2961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2961_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 281
Target Start/End: Complemental strand, 35620431 - 35620151
Alignment:
| Q |
1 |
acgcttcgtgtggacttgcacgtgtcgcatgacctttaattgcggagatgtttgtacggtactgttcataattcataggacatcgagccaaacacaaccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35620431 |
acgcttcgtgtggacttgcacgtgtcgcatgacctttaattgcggagatgtttgtacggtactgttcataattcatagtacatcgagccaaacacaaccc |
35620332 |
T |
 |
| Q |
101 |
atgctccattttagtcctcatatagccacggaaattgctggagaattactcaagtggagccttcggctttcgattgagagagtagccatcggatcccatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| ||| || |||||| |
|
|
| T |
35620331 |
atgctccattttagtcctcatatagccacggaaattggtggagaattactcaagtggagccttcgggtttcgattgagagagtagctatcagaacccatt |
35620232 |
T |
 |
| Q |
201 |
tgtgtaacattgtgtcgagactgtcacatgacattgtgaaagagaaagaaaagttaacaacaaaatcacgtgtcatattat |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35620231 |
tgtgtaacattgtgtcgagactgtcacatgacattataaaagagaaagaaaagttaacaacaaaatcacgtgtcatattat |
35620151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University