View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2961_high_9 (Length: 334)
Name: NF2961_high_9
Description: NF2961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2961_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 116; Significance: 6e-59; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 48 - 183
Target Start/End: Original strand, 8771641 - 8771775
Alignment:
| Q |
48 |
tcgaccgacaatcacatgatattttggtggcgggccttctgatttatctccactgcataatttctctcagcacatcgccgccaagattaggatgggaaaa |
147 |
Q |
| |
|
||||||||||||| |||||||||| | |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8771641 |
tcgaccgacaatcgcatgatatttcg-tggcgggccttctgatttatctccacggcataatttctctcagcacatcgccgccaagattaggatgggaaaa |
8771739 |
T |
|
| Q |
148 |
ttaagtacaattattttcaatatcttggtcttatat |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
8771740 |
ttaagtacaattattttcaatatcttggtcttatat |
8771775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 240 - 306
Target Start/End: Original strand, 8771833 - 8771899
Alignment:
| Q |
240 |
gggacgctagcaacaactctgatgcttcaaccatgacaagaagatagttgacttgccatgaccatca |
306 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
8771833 |
gggacgcgagcaacaactctgatgcatcaaccatgacaggaagatagttaacttgccatgaccatca |
8771899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 125 - 181
Target Start/End: Complemental strand, 16963585 - 16963529
Alignment:
| Q |
125 |
ccgccaagattaggatgggaaaattaagtacaattattttcaatatcttggtcttat |
181 |
Q |
| |
|
||||||| ||| ||||| || || |||||||||||||||| |||||||||||||||| |
|
|
| T |
16963585 |
ccgccaaaatttggatgagagaagtaagtacaattattttaaatatcttggtcttat |
16963529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University