View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2961_low_20 (Length: 262)
Name: NF2961_low_20
Description: NF2961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2961_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 71 - 252
Target Start/End: Original strand, 35620659 - 35620842
Alignment:
| Q |
71 |
aagatgtacgtacaagtgatgtgatgatcttatacatgtgtgcatgtgtgcatttcaatactcttaatttgcacatagcatttgaaggacaacttattag |
170 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35620659 |
aagatgtacgtacaagtgatgtgatcatcttatacatgtgtgcatgtgtgcatttcaatactcttaatttgcacatagcatttgaaggacaacttattag |
35620758 |
T |
 |
| Q |
171 |
cccattgacttgatcagctgtttcattgtgggttaagttgttgaattgtattgt--tataaatggtataaatcttggcctctgt |
252 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
35620759 |
cccattgacctgatcagctgtttcattgtgggttaagttgttgaattgtattgttatataaatggtataaatcttggcatctgt |
35620842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University