View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2961_low_25 (Length: 237)
Name: NF2961_low_25
Description: NF2961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2961_low_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 60 - 223
Target Start/End: Complemental strand, 32741653 - 32741490
Alignment:
| Q |
60 |
ggatcatggtgctgtttgctgctaaaactacttctgcagtctcttttttggtgtaggatagcgctgctgtgttagggctcgtagtatggcaggctttgct |
159 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32741653 |
ggatcatggagctgtttgctgctaaaactacttctgtagtctcttttttggtgtaggatagcgctgctgtgttagggctcgtagtatgccaggctttgct |
32741554 |
T |
 |
| Q |
160 |
aagttgttagagcagcagctttggttttccatgtttggagtttatgggaagtgtcccgtttttg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32741553 |
aagttgttagagcagcagctttggttttccatgtttggagtttatgggaagtgtcccgtttttg |
32741490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University