View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2961_low_26 (Length: 225)
Name: NF2961_low_26
Description: NF2961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2961_low_26 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 40846760 - 40846540
Alignment:
| Q |
1 |
tactgctgcaaagtgcaaacctaacaatgcaggtaaaacgaatcagctgacaagattataaagttgcgttgnnnnnnnnaagctgttggatataattatt |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
40846760 |
tactactgcaaagtgcaaacctaacaatgcaggtaaaacgaatcagctgacaagattataaagttgcgttgttttttttaagctgttggata--attatt |
40846663 |
T |
 |
| Q |
101 |
acacagtctagattacaacttcttcaaaccattgactttatttttataagcataatttttattgaaagagactaaactagcacaagatgtgcaaagtagc |
200 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40846662 |
aca--gtctagattacaacttcttcaaaccattgactttatttttataagcataatttttattgaaagagactaaactagcacaagatgtgcaaagtagc |
40846565 |
T |
 |
| Q |
201 |
tctaagaccatcatacagttcaatg |
225 |
Q |
| |
|
||||||||||||| ||||||||||| |
|
|
| T |
40846564 |
tctaagaccatcacacagttcaatg |
40846540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University