View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2962_low_16 (Length: 219)
Name: NF2962_low_16
Description: NF2962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2962_low_16 |
 | |
|
| [»] scaffold0010 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0010 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 23 - 208
Target Start/End: Complemental strand, 144418 - 144233
Alignment:
| Q |
23 |
tagtttattttaattattatatatagattgcagtgatgatgcgtgataccttatatgttttctattaacttagtatagcctattatannnnnnnngaaag |
122 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
144418 |
tagtttattttaattattgtatatagattgcagtgatgatgcgtgataccttatatattttctattaacctagtatagcctattatatttgttttgaaag |
144319 |
T |
|
| Q |
123 |
gatagtagacctaattctagttttctctcgttccactcatgcgccgtcaatagtatttgtttccaccctccttcatatctttgatg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
144318 |
gatagtagacctaattctagttttctctcgttcctttcatgcgccgtcaacagtatttgtttccaccctccttcatatctttgatg |
144233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 23 - 208
Target Start/End: Original strand, 19726383 - 19726588
Alignment:
| Q |
23 |
tagtttattttaattattatatatagattgcagtgatgatgcgtgataccttatatgttttctattaa--------------------cttagtatagcc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | |||||||||| |
|
|
| T |
19726383 |
tagtttattttaattattatatatagattgcagtgatgatgcgtgataccttatatattttctattaagcttgtatattttctattaacctagtatagcc |
19726482 |
T |
|
| Q |
103 |
tattatannnnnnnngaaaggatagtagacctaattctagttttctctcgttccactcatgcgccgtcaatagtatttgtttccaccctccttcatatct |
202 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |||||||||||||||||| |||||||| | |
|
|
| T |
19726483 |
tattatatttgttttgaaaggatagtagacctaattttagttttctctcgttccactcatgcaccgtcaacagtatttgtttccacccttcttcatatat |
19726582 |
T |
|
| Q |
203 |
ttgatg |
208 |
Q |
| |
|
|||||| |
|
|
| T |
19726583 |
ttgatg |
19726588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 23 - 109
Target Start/End: Original strand, 16066779 - 16066865
Alignment:
| Q |
23 |
tagtttattttaattattatatatagattgcagtgatgatgcgtgataccttatatgttttctattaacttagtatagcctattata |
109 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||||||||| |||| | |||||| ||||| ||||||||||||||||| |
|
|
| T |
16066779 |
tagtttattttaattattatatatagattttggtaatgatgcgtgatacattatctattttcttttaacctagtatagcctattata |
16066865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University