View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2962_low_17 (Length: 206)

Name: NF2962_low_17
Description: NF2962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2962_low_17
NF2962_low_17
[»] chr2 (2 HSPs)
chr2 (94-190)||(6019494-6019590)
chr2 (15-106)||(6021288-6021379)


Alignment Details
Target: chr2 (Bit Score: 89; Significance: 4e-43; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 94 - 190
Target Start/End: Complemental strand, 6019590 - 6019494
Alignment:
94 gatacagatataaagaaactacaaatcggttcttttcttaacaaccattttataaaaaggacaaataattaaataattactggccacaataacatgt 190  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
6019590 gataaagatataaagaaactacaaatcggttcttttcttaacaaccattttataaaaagaacaaataattaaataattactggccacaataacatgt 6019494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 15 - 106
Target Start/End: Original strand, 6021288 - 6021379
Alignment:
15 gagaagcaggaaggctagagaaaaatctaggcaagaccatattagggaactaaattgtctgagtgatgaaattaatatggatacagatataa 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
6021288 gagaagcaggaaggctagagaaaaatctaggcaagaccatattagggaactaaattgtctgagtgatgaaattaatatggatgcagatataa 6021379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University