View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2962_low_4 (Length: 333)
Name: NF2962_low_4
Description: NF2962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2962_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 39 - 282
Target Start/End: Original strand, 3680977 - 3681222
Alignment:
| Q |
39 |
acttttaatcaaaatcatttcttttatcagagaaccaaaaatac--ttaggttaaggtaatatttggcagcttattgtggagagtgattctaagtttaaa |
136 |
Q |
| |
|
||||||||| ||||||| ||||||||| ||||||||||| | || ||| ||||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3680977 |
acttttaattaaaatcaattcttttattagagaaccaaacacacacttaagttaaagtaatatttggcagcttattgtggagagtgattctaactttaaa |
3681076 |
T |
 |
| Q |
137 |
gagtcatcttcgcaatcttcaaactttggattagcaacgcgaggggaacgtaacttattaattttagtttcatcccttcatttatcacagtgggaccgat |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3681077 |
gagtcatcttcgcaatcttcaaactttggactaacaacgcgagggaaacgtaacttattaattttagtttcatcctttcatttatcacagtgggaccgat |
3681176 |
T |
 |
| Q |
237 |
atacctctataatagattacctaccagcttttgcttagattcatta |
282 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
3681177 |
atacctctataatagattacctactagcttttgcttagatttatta |
3681222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University