View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2962_low_9 (Length: 245)
Name: NF2962_low_9
Description: NF2962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2962_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 19 - 231
Target Start/End: Original strand, 28129527 - 28129739
Alignment:
| Q |
19 |
cttttgtcgatgattaatctctgtagtggattctctccactcaacatgttttcattcagagcgttcaaacccgagactttattttagagattaagagaga |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28129527 |
cttttgtcgatgattaaactctgtagtggattctctccactcaacatgttttcattcagagcgttcaaacccgagactttattttagagattaagagaga |
28129626 |
T |
 |
| Q |
119 |
gtgaagtgatgagtactaaccaatgcaaatccacctctagcgcaccaagtttttggcatggtggtagaacgagcgccataccactctgggagactagttt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28129627 |
gtgaagtgatgagtactaaccaatgcaaatccacctctagcgcaccaagtttttggcatggtggtagaacgagcgccataccactctgggagactagttt |
28129726 |
T |
 |
| Q |
219 |
tccccagaataat |
231 |
Q |
| |
|
||||||||||||| |
|
|
| T |
28129727 |
tccccagaataat |
28129739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 110 - 228
Target Start/End: Original strand, 28114076 - 28114201
Alignment:
| Q |
110 |
taagagagagtga-agtgatgagtacta---accaatgcaaatccacctctagcgcaccaagtttttg---gcatggtggtagaacgagcgccataccac |
202 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||| ||||||||||||||| |||||||| || | |||| | | ||||||| ||||||||| |
|
|
| T |
28114076 |
taagagagagtgatagtgatgagtactactaaccaagccaaatccacctctagggcaccaagcttgtcctagcatttttgaagaacgaatcccataccac |
28114175 |
T |
 |
| Q |
203 |
tctgggagactagttttccccagaat |
228 |
Q |
| |
|
||||| |||||||||||||||||||| |
|
|
| T |
28114176 |
tctggaagactagttttccccagaat |
28114201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University