View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2963_high_16 (Length: 225)
Name: NF2963_high_16
Description: NF2963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2963_high_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 41822881 - 41823091
Alignment:
| Q |
1 |
tgggattatgtatttagttgaaaataaataaggtttttgacctaacctaaaccatacaaaagaaaattgaatgggtttcttttgtcatataaaatcatac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41822881 |
tgggattatgtatttagttgaaaataaataaggtttttgacctaacctaaaccatacaaaagaaaattgaatgggtatcttttgtcatataaaatcatac |
41822980 |
T |
|
| Q |
101 |
tctc--ttttttaaacaataaaatcatattctctaaatatcgtgttaaatcttaaaatattgtttaatctcatttatttattaattagctcgttagtatt |
198 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41822981 |
tctcttttttttaaacaataaaatcatactctctaaatatcgtgttaaatcttaaaatattgtttaatctcatttatttattaattagctcgttagtatt |
41823080 |
T |
|
| Q |
199 |
ttaaaatatat |
209 |
Q |
| |
|
||||||||||| |
|
|
| T |
41823081 |
ttaaaatatat |
41823091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University