View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2963_high_3 (Length: 461)
Name: NF2963_high_3
Description: NF2963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2963_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 5e-60; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 5e-60
Query Start/End: Original strand, 232 - 450
Target Start/End: Complemental strand, 53207593 - 53207376
Alignment:
| Q |
232 |
gacttcccttggacaaatatatagcatgttaatctcattttatatatttgatgcttttgcatgaaattattttgggagagtt-ggacaacctaaccctta |
330 |
Q |
| |
|
|||||||||||| || ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
53207593 |
gacttcccttgggcagatatataacatgttaatctcattttatatatttgatgcttttgcatgaaattaatttgggagagttgggacaacctaaccctta |
53207494 |
T |
 |
| Q |
331 |
ataaaattttacaggtatataagtctcattcaattgnnnnnnnnnnnnnnnnngaagccccacttccacatgcaaacaagccttctagctcttccatccc |
430 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| || ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
53207493 |
ataaaattttaccggtatataagtctcattcaattgaaaaaaaaaaaaaaaaaaaa--cccacttccacatgcaaacaagccttccagctcttccatccc |
53207396 |
T |
 |
| Q |
431 |
atcatatccatatctttcat |
450 |
Q |
| |
|
||||||||||||| |||||| |
|
|
| T |
53207395 |
atcatatccatatttttcat |
53207376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University